Conversion of sequence from one database format to another using file format converter
1. First line of FASTA Sequence begins with
2. File extension for GenBank files
3. Identify the file formats having end of the sequence is marked by two slashes.
4. EMBL refers to
5. Identify the given sequence; ATTGCCCAACCGTTCATGACCGG as a